Genome-wide Chromatin Motif

There are 245 Motifs.

Rank Motif Antisense Motif P value TFe Annotation hDPI Logo (match score) hDPI Motif Inaccessible occurrence Accessible occurrence
1CACGTGCACGTG7.61E-8USF2(7.2) USF1(7.4) CREB1 TSNAX ZBTB7A TFEB USF1 IRF3 MLX USF2 MAX 1.15%0.69%
2CTCCTGACGTCAGGAG2.36E-6RXR/RAR2.86%2.45%
3CTGCAGCTGCAG3.34E-6MAX IRF3 ZBTB25 2.81%2.40%
4TTTAGTAGAGCTCTACTAAA3.42E-61.39%1.07%
5AGTAGAGATCTCTACT5.71E-62.16%1.85%
6GTGAAACCCGGGTTTCAC7.98E-6HCFC2(6.9) RAB18(6.1) ZNF193(5.2) 2.59%2.16%
7GGTGAAACCCGGGTTTCACC1.23E-5HCFC2(6.9) RAB18(6.1) ZNF193(5.2) 2.16%1.74%
8CTCCTGACCTAGGTCAGGAG1.33E-5RXR/RARCREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.26%1.85%
9AGGTCAGGATCCTGACCT1.41E-5RXR/RARCREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.40%2.01%
10TCAGGATCCTGA1.85E-57.03%6.41%
11TTAGTAGAGATCTCTACTAA1.94E-51.49%1.20%
12TAGTAGAGATCTCTACTA1.94E-51.75%1.46%
13CTCTACTAATTAGTAGAG3.2E-51.56%1.28%
14TAGTAGAGCTCTACTA3.2E-51.81%1.53%
15TGCCAATTGGCA3.64E-5CCDC16 RAB18 MAX PAXIP1 LIN28 PRDM10 CNBP NPM1 0.88%1.24%
16GTTTCACCGGTGAAAC4.01E-5RAB18(6.1) ZNF193(5.2) 2.71%2.31%
17TGAAACCCGGGTTTCA4.01E-5HCFC2(6.9) ZNF193(5.2) 2.84%2.44%
18GGTTTCACGTGAAACC4.01E-5STAT1RAB18(6.1) ZNF193(5.2) 3.00%2.61%
19CAGGCTGGAGCTCCAGCCTG5.68E-51.39%1.05%
20GGTTTCACCGGTGAAACC6.08E-5RAB18(6.1) ZNF193(5.2) 2.47%2.08%
21ATGTATACATATGTATACAT6.31E-51.05%0.74%
22ACCTCTGCAGAGGT7.41E-5HIFALPHAAFF4 GLRX2 LIN28 RCOR3 LOC93349 THRAP6 NRF1 CBX7 ZNF691 TP73 IRF3 CNBP MAX ZBTB7A ZNF555 RXRA 1.09%0.84%
23GTCAGGATCCTGAC8.15E-5RXR/RAR3.58%3.19%
24TCTCTACGTAGAGA9.86E-5SOX92.70%2.39%
25AGTAGAGCTCTACT1.0E-4SPI12.35%2.07%
26TCCAGCGCTGGA1.03E-44.22%3.76%
27ATCACAATTGTGAT1.14E-4SOX92.06%1.71%
28CTCCTGACCGGTCAGGAG1.14E-4RXR/RAR2.53%2.18%
29GTGAAACGTTTCAC1.18E-4STAT1RAB18(6.1) ZNF193(5.2) 3.58%3.14%
30TGTTAGCCATGGCTAACA1.44E-41.25%1.01%
31TCAGAGATCTCTGA1.56E-4ATF2IRF8 METTL3 ZNF76 RBPJ SCMH1 ZNF606 LOC93349 ETV7 TFAM CNBP CBFA2T3 ZBTB22 TFE3 ZNF3 RCOR3 TTRAP SMARCAL1 MYEF2 PRDM10 ZNF461 TCF3 ZNF691 ING1 MAX LIN28 YBX1 KHDRBS1 ZNF498 IRF3 1.43%1.14%
32CAGGCTGGATCCAGCCTG1.56E-41.55%1.20%
33GAGGTCAGGATCCTGACCTC1.56E-4RARACREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.03%1.69%
34TTTTAGTAGATCTACTAAAA1.57E-41.37%1.11%
35TCTACTAAATTTAGTAGA1.57E-41.53%1.28%
36TTTTTAGTAGCTACTAAAAA1.62E-41.20%0.93%
37TCAGGAGCTCCTGA1.62E-4PPARA4.43%4.02%
38CCAGGCTGCAGCCTGG1.73E-4CREB1PIR(5.0) SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 3.44%3.00%
39GGGGTTTCACGTGAAACCCC1.74E-4HCFC2(6.9) RAB18(6.1) ZNF193(5.2) ZNF160(5.7) 1.85%1.52%
40ACTCCAGCCTAGGCTGGAGT2.08E-41.39%1.05%
41TGCCCTAGGGCA2.34E-41.37%1.75%
42GGTTTCATGAAACC2.34E-4STAT1ZNF193(5.2) 3.60%3.21%
43TATAGCGCTATA2.38E-40.88%1.11%
44GTTAGCCATGGCTAAC2.38E-41.33%1.10%
45GCCTGGCCAATTGGCCAGGC2.45E-41.34%1.06%
46GCCTGGCCGGCCAGGC2.45E-41.69%1.41%
47TGTTAGCCAGCTGGCTAACA2.6E-41.18%0.92%
48ACCTCTAGAGGT2.71E-4ZNF510 CCDC16 NME1 ZNF313 TRMT1 LIN28 NPM1 RAB18 CNBP 2.09%1.75%
49TTTCACCGGTGAAA2.71E-4PPARG-RXRARAB18(6.1) ZNF193(5.2) ZNF510 CCDC16 NME1 ZNF313 TRMT1 LIN28 NPM1 RAB18 CNBP 3.30%2.95%
50GTGTGGCCACAC2.74E-42.61%2.27%
51TGTCCTTAAGGACA2.96E-4HIFALPHAZNF691 ZBTB7A ZBTB22 CBFA2T3 TGIF1 CNBP ZNF498 SMARCAL1 HTATIP SOX9 MAX KHDRBS1 YEATS4 GLRX2 IRF3 NME2 TTRAP 1.76%1.46%
52AGACTTAAGTCT3.11E-4RCOR3 KHDRBS1 ZNF691 NME1 PBX2 LIN28 SMARCC2 MAX TTRAP IRF3 PRDM10 2.48%2.13%
53CCTGACCTAGGTCAGG3.27E-4NR1H2-RXRCREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.66%2.36%
54ATCAGATCTGAT3.46E-4RCOR3 PPIE ZNF461 OTEX KHDRBS1 ZNF691 CBFA2T3 PRDM10 MAX ZNF784 METTL3 SMARCAL1 ZNF498 IRF3 3.07%2.66%
55ATGTATACATGTATACAT3.85E-41.15%0.88%
56TGGCCAGGCGCCTGGCCA3.85E-41.42%1.15%
57CACATTGCAATGTG4.01E-4THMG20A(5.5) 1.25%0.95%
58GCTGGAGCTCCAGC4.02E-4HIFALPHA2.71%2.38%
59AGTGTGCACACT4.02E-42.85%2.44%
60GTCAGGAGTTAACTCCTGAC4.15E-4RXR/RAR1.25%1.02%
61TCTCCTGACGTCAGGAGA4.15E-4RXR/RAR1.34%1.11%
62CTGCACTCCATGGAGTGCAG4.18E-4MTF11.12%0.88%
63TTCAGGATCCTGAA4.18E-4STAT321.29%1.05%
64AGGCTGGAGCTCCAGCCT5.31E-41.53%1.23%
65GGTCAGGATCCTGACC5.31E-4RXR/RAR2.70%2.39%
66TAGCCATGGCTA5.77E-43.22%2.85%
67CAGCCTGGCCGGCCAGGCTG6.03E-4PIR(5.0) 1.38%1.12%
68TGCTTCTAGAAGCA6.06E-4PU.1MXD3 ZNF498 ZNF461 MAX LIN28 KHDRBS1 ZNF34 LARP1 YBX1 TTRAP PRDM10 0.91%1.19%
69GCCAACATGGCCATGTTGGC6.06E-41.24%0.95%
70AGGTCAGCTGACCT6.06E-4NR1H2-RXRCREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) ESRRA SMARCAL1 PRDM10 3.26%2.96%
71TTTTAGTAGCTACTAAAA6.69E-41.43%1.20%
72ATTGCCGGCAAT6.84E-4GTF2B(6.4) TFAM PKNOX1 GTF3C2 ZNF461 GTF2B NRF1 YBX1 ZNF498 ZBTB4 ZNF606 RCOR3 IRF8 SOX9 ENO1 CBX7 PBX2 MNDA ETV7 SMARCC2 TERF1 CNBP MAX KHDRBS1 PRDM10 TTRAP IRF3 LIN28 1.47%1.83%
73CCCGGGCCCGGG6.86E-41.25%0.97%
74TCCAGCCTGGCCAGGCTGGA6.87E-4PIR(5.0) SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 1.32%1.01%
75ACTCCAGCGCTGGAGT7.71E-41.75%1.48%
76TCTGCATGCAGA7.71E-43.38%3.01%
77CAGGCTGCAGCCTG7.71E-4CREB1IRF3 TFAM TERF1 ZNF671 CNBP PRDM10 LIN28 PKNOX1 MEIS2 4.53%4.14%
78TGGCGTACGCCA7.88E-40.79%1.12%
79ACGTATATACGT8.1E-41.21%0.86%
80GCCTCCCGGGAGGC8.1E-4HIFALPHA3.61%3.27%
81TGGCCAGGCTAGCCTGGCCA8.57E-4PIR(5.0) 1.29%1.03%
82GCCAGGCGCCTGGC8.73E-4HIFALPHA2.49%2.18%
83GGCCAGGCTAGCCTGGCC9.4E-4PIR(5.0) 1.43%1.19%
84TAGTAGATCTACTA9.4E-4T2.16%1.92%
85CCAGCCTGGCCAGGCTGG9.49E-4PIR(5.0) SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 3.14%2.77%
86ACTGAGCTCAGT9.59E-4ZNF691 RBBP5 PAPD1 CHES1 ZBTB43 SMARCC2 HTATIP RAB18 TERF1 PRDM10 IRF3 LIN28 MAX CNBP NRF1 2.07%1.74%
87CTGAAGCTTCAG0.00102NCALD ZNF461 LIN28 LOC93349 ZBTB4 CNOT6 TERF1 MNDA RBPJ CBFA2T3 TCF7 PPIE ZNF498 ZNF34 TFAM ETV7 PRDM10 CREB5 ZNF606 MAX YBX1 OTEX SMARCAL1 ZNF784 KHDRBS1 RCOR3 ZNF691 IRF3 1.92%1.62%
88TTCCTCTAGAGGAA0.00106SPIB1.11%0.92%
89CCTGACGTCAGG0.00106HTATIP TFE3 ZNF720 FOXN2 ZNF461 CNOT6 JARID1D ZNF34 TSNAX KHDRBS1 ZNF250 HCLS1 ZNF691 CBFA2T3 PRDM10 BCL11A RCOR3 ZNF160 MYEF2 JMJD2C ZNF784 MLX TTRAP SMARCC2 LIN28 ETV7 CNBP ZRANB2 5.39%4.99%
90CTGCACTCCGGAGTGCAG0.00107MTF11.23%1.01%
91TGGTCTCGATCGAGACCA0.00109SMAD3(5.0) 2.04%1.74%
92CCTGAATTCAGG0.001132.64%2.30%
93CACCCTAGGGTG0.001151.18%1.48%
94CACTCCAGCTGGAGTG0.001181.65%1.39%
95CAGCTGCAGCTG0.00132SFMBT1 CHES1 ZNF238 PBX2 PRDM10 ZRANB2 CNBP LIN28 PKNOX1 IRF3 MEIS2 1.84%1.48%
96ATTCAGGCCTGAAT0.00132MEF2A1.11%0.87%
97AAAAATTATAATTTTT0.00132SF1(6.4) 1.51%1.26%
98CCGGCTAGCCGG0.00134ZBTB22 YEATS4 MAX KHDRBS1 IRF3 HTATIP GLRX2 0.96%1.26%
99TGCACTCCAGCTGGAGTGCA0.00136MTF11.42%1.15%
100ACTCCAGCTGGAGT0.00136HAND1-TCF32.02%1.75%
101GCCAGGCTAGCCTGGC0.00146PIR(5.0) 1.74%1.51%
102TCTTCTAGAAGA0.00153MYEF2 ZNF34 YBX1 ZNF691 LIN28 TTRAP PPIE 3.74%3.37%
103CACTCCAGCGCTGGAGTG0.001561.51%1.25%
104CTGGCCAATTGGCCAG0.001561.89%1.63%
105TGGCAATTGCCA0.00158ZNF606 ZNF498 PRDM10 RFX3 TTRAP GTF3C2 HCLS1 GLRX2 RCOR3 TAF1A SFMBT1 LOC653972 TTF2 SOX9 ENO1 MEIS2 GTF2B LOC93349 NMRAL1 NRF1 TERF1 CNOT6 SMARCC2 RBPJ THRA MAX ETV7 MNDA PKNOX1 IRF3 2.12%2.47%
106CCACACCGGTGTGG0.001591.03%0.87%
107CTACTAAATTTAGTAG0.001591.62%1.41%
108GAGAATGATCATTCTC0.0017ZBTB43(5.5) 1.11%0.91%
109CTGGCTAACGTTAGCCAG0.00171.20%1.00%
110GTCAGGAGATATCTCCTGAC0.0017RXR/RAR1.21%1.01%
111GCCAGGCCTGGC0.00173ETV7 ZNF498 YBX1 APLP2 MAX OTEX TCF7 ING1 IRF3 CREB5 ZNF691 4.88%4.48%
112CAGTGTGCACACTG0.001861.47%1.19%
113GCTTCTAGAAGC0.00188MXD3 ZNF498 ZNF461 MAX LIN28 KHDRBS1 ZNF34 LARP1 YBX1 TTRAP PRDM10 1.83%2.13%
114TCCAGCCTAGGCTGGA0.001921.72%1.43%
115GGCCAACATGTTGGCC0.001921.83%1.53%
116GAAACCCGGGTTTC0.00192HCFC2(6.9) HDAC1 SND1 CBFA2T3 HTATIP ZRANB2 LOC93349 ZNF26 CREB1 HCFC2 ZNF498 NME2 ETV7 NFATC1 LIN28 RXRA IRF3 MAX HSF1 3.61%3.32%
117TGTATACATGTATACA0.002021.43%1.20%
118CAGCCTGGCGCCAGGCTG0.00202PIR(5.0) 1.61%1.38%
119TAACTCGAGTTA0.002031.18%1.43%
120TGCACTCCATGGAGTGCA0.00203MTF11.53%1.28%
121CCTGACCTCGAGGTCAGG0.00203RARACREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.21%1.95%
122TTTCACGTGAAA0.00207RAB18(6.1) ZNF193(5.2) LIN28 NPM1 CNBP PPIE PRDM10 5.68%5.26%
123TGTTGGCCAGCTGGCCAACA0.002191.46%1.19%
124GTTTCACCATATGGTGAAAC0.00219RAB18(6.1) CCDC16(5.2) ZNF193(5.2) 1.55%1.28%
125TACTAAATTTAGTA0.00226RXRA ZNF3 ZNF784 SFMBT1 NPM1 NME2 LIN28 ZRANB2 LOC653972 BCL11A MLX TERF1 CREB1 CBFA2T3 ZBTB25 PLAGL1 PQBP1 HTATIP GLRX2 IRF3 SMARCC2 MAX 2.04%1.83%
126AGAAGAATTCTTCT0.00231SPI1MYEF2 ZNF34 YBX1 ZNF691 LIN28 TTRAP PPIE 1.56%1.37%
127TACCCTAGGGTA0.002341.00%0.75%
128ACTGCACTCCGGAGTGCAGT0.00249MTF11.10%0.89%
129AAATGGATCCATTT0.00257CBFB(6.0) MNDA IRF8 ZNF3 RBPJ LOC93349 TFE3 OTEX ING1 ZBTB22 MAX NFATC3 ZNF498 NFATC1 IRF3 1.70%1.44%
130CCCACCTAGGTGGG0.00257HIF1AFF4(6.2) 1.70%1.44%
131AAGATCGATCTT0.002612.16%2.47%
132AGCTGGCCAGCT0.00263GLRX2 ETV7 LIN28 IRF3 MAX 4.22%3.84%
133CTTGTGATATCACAAG0.00271.07%0.84%
134TTTTTAGTATACTAAAAA0.00271.35%1.16%
135CTGGAGTGCGCACTCCAG0.00271.53%1.30%
136ATGGTGAAATTTCACCAT0.0027RAB18(6.1) CCDC16(5.2) ZNF193(5.2) 1.79%1.52%
137GCTAACATGTTAGC0.0027SOX101.84%1.65%
138AAAAATTAATTTTT0.0027SOX9SF1(6.4) 2.25%1.98%
139CCCACCGGTGGG0.0027AFF4(6.2) HTATIP ENO1 NME2 GLRX2 HCLS1 TADA2L 3.00%2.67%
140ATCTTTAAAGAT0.0027ZNF461 HCFC2 RAN OTEX CBFA2T3 LOC93349 TTRAP CNOT6 ZNF160 ZNF784 TFAM ENO1 ZNF606 ZNF34 MNDA ETV7 IRF8 METTL3 RCOR3 YBX1 ZNF498 RBPJ SMARCAL1 PPIE MAX KHDRBS1 LIN28 ZNF691 IRF3 2.72%3.07%
141CCAGCCTGCAGGCTGG0.0027SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 4.02%3.68%
142CCATGTTGGCCAACATGG0.002751.90%1.61%
143TCAGATATCTGA0.00286FOXM1 RXRA RCOR3 SMARCAL1 TBPL1 ZNF461 PRDM10 OTEX CNBP MAGEF1 KHDRBS1 NFATC3 SCMH1 YBX1 ZNF498 ING1 NFATC4 MAX TCF7 IRF3 ZNF691 CREB5 NFATC1 2.76%2.43%
144TGGTGAAACCGGTTTCACCA0.0030RAB18(6.1) CCDC16(5.2) ZNF193(5.2) 1.55%1.30%
145GGGAATATTCCC0.0030HDAC1 SND1 CBFA2T3 HTATIP ZRANB2 LOC93349 ZNF26 CREB1 HCFC2 ZNF498 NME2 ETV7 NFATC1 LIN28 RXRA IRF3 MAX HSF1 1.90%2.15%
146TGGAGTGCGCACTCCA0.003081.66%1.44%
147CCTGATATCAGG0.003191.15%1.41%
148CATGGTGAAATTTCACCATG0.00319RAB18(6.1) CREB3L1(5.5) CCDC16(5.2) ZNF193(5.2) 1.46%1.20%
149TGAAACCCCGGGGTTTCA0.00319HCFC2(6.9) ZNF193(5.2) ZNF160(5.7) 1.97%1.71%
150AGCCAGCTGGCT0.00324NME1 CCDC16 NPM1 TRMT1 PAXIP1 RAB18 PPIE LIN28 PRDM10 CNBP 3.32%3.00%
151TACCCAGCTGGGTA0.00348RORA11.03%0.83%
152GTTAGCCAGGCCTGGCTAAC0.003481.12%0.92%
153AAATTAGCGCTAATTT0.00348PQBP1(6.6) PLAGL1(6.8) NME1 C13orf15 CBFA2T2 SMARCAL1 ZBTB7A PAXIP1 CNBP DDX20 IRF3 ZNF691 TRMT1 RAB18 CCDC16 PRDM10 1.39%1.19%
154GCACTCCAGCGCTGGAGTGC0.00351.43%1.20%
155GAAGAATTCTTC0.00354MYEF2 ZNF34 YBX1 ZNF691 LIN28 TTRAP PPIE 4.43%4.18%
156TTCAGTACTGAA0.00365ING1 HMGN1 RCOR3 ZNF606 TTRAP RAN CNOT6 TRIM32 ZNF498 SMARCAL1 LOC93349 MNDA KHDRBS1 YBX1 PRDM10 IRF3 ZNF691 MAX 2.62%2.31%
157AAGGACGTCCTT0.00376TRMT1 ESRRA RAB18 LIN28 GPAM CNBP 2.99%2.70%
158ATCATTCTAGAATGAT0.00389PBXZBTB43(5.5) 1.02%0.83%
159TCCTGGCTAATTAGCCAGGA0.003891.11%0.92%
160GGTCAGGAGATCTCCTGACC0.00389RXR/RAR1.19%1.00%
161ACTCCTGACGTCAGGAGT0.00389RXR/RAR1.32%1.12%
162TCCAAATTTGGA0.00389YEATS4(6.0) SFMBT1 NPM1 SMARCAL1 TRMT1 PRDM10 PPIE 2.29%2.55%
163ATGTTGGCCGGCCAACAT0.003921.61%1.34%
164TCCAAGCTTGGA0.00406CEBPG(5.0) NME1 PAXIP1 THAP3 LIN28 GPAM CBFA2T2 TRMT1 DDX20 PRDM10 RAB18 CCDC16 CNBP 1.79%1.57%
165ACTCATATGAGT0.00438SMAD4 NCALD SFMBT1 THRA CBFA2T3 RCOR3 ZBTB4 LIN28 CNOT6 PPIE TERF1 ZNF34 ETV7 ZNF160 LOC93349 SND1 ZNF691 RBPJ MNDA ZNF606 ENO1 PKNOX1 MAX ZRANB2 METTL3 PRDM10 KHDRBS1 YBX1 IRF3 TTRAP 2.62%2.94%
166GCTAGATCTAGC0.004420.83%1.06%
167GTTTCACCATGGTGAAAC0.00442RAB18(6.1) CCDC16(5.2) ZNF193(5.2) 1.71%1.48%
168CCAGACGTCTGG0.00462TRMT1 LIN28 PRDM10 RAB18 CNBP 1.03%1.26%
169TCGAGACCGGTCTCGA0.004632.18%1.92%
170GCCAGGCTGGCCAGCCTGGC0.00467PIR(5.0) SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 1.42%1.21%
171CCTGGCTAATTAGCCAGG0.004671.58%1.33%
172TGCTATATAGCA0.004671.80%2.03%
173ATGGTGATCACCAT0.00467NFE2L2(NRF2)2.77%2.44%
174ATGTTATAACAT0.005053.03%2.68%
175ATCACTTAAGTGAT0.00519SPIB1.55%1.33%
176GCTAATTTTTAAAAATTAGC0.00534PQBP1(6.6) SF1(6.4) PLAGL1(6.8) 1.07%0.88%
177AAAAATTAGCTAATTTTT0.00534PQBP1(6.6) SF1(6.4) PLAGL1(6.8) 1.19%1.00%
178TTAGTAGATCTACTAA0.00534T1.72%1.53%
179CAGCCTGGGCCCAGGCTG0.00548AP2APIR(5.0) 1.35%1.12%
180GGAGTGCATGCACTCC0.00548MTF11.71%1.48%
181CTGACCTCGAGGTCAG0.00548THRB/RXRACREB1(6.6) ZNF655(7.5) ZNF313(6.4) RXRA(6.8) USF2 RCOR3 RBM9 GLRX2 ZNF606 CBFA2T3 YBX1 HTATIP IRF3 ESRRA MAX 2.55%2.32%
182ATTAATATTAAT0.00554HDAC8(6.8) ZNF498 TRMT1 JARID1D TERF1 RCOR3 MAX NME2 ZNF691 IRF3 ZNF34 METTL3 CNBP TTRAP LIN28 SMARCAL1 PPIE SOX9 PRDM10 1.69%1.43%
183TTAGCCAGCTGGCTAA0.005581.72%1.48%
184CATGGTGCACCATG0.00562SRFCREB3L1(5.5) 2.89%2.59%
185TGTTTTAAAACA0.00591TRMT1 NPM1 RAB18 LIN28 CNBP 4.99%5.34%
186CTTTGTATACAAAG0.00604SPIBZNF131(6.5) JARID1D(7.3) RFXANK(5.6) SFMBT1 JARID1D ZNF784 ZNF461 MAX KHDRBS1 PPIE SMAD4 YBX1 ZNF34 ZNF691 PRDM10 1.18%1.00%
187AACTCCTGATCAGGAGTT0.00604RXR/RAR1.38%1.20%
188GAGTGCAGCTGCACTC0.00604MTF11.42%1.24%
189ATCGAGACCATGGTCTCGAT0.00607SMAD3(5.0) 1.07%0.87%
190GTGAGATATCTCAC0.00607HIFALPHA1.18%0.97%
191CTGCACTAGTGCAG0.006071.85%1.63%
192TTTGTGTACACAAA0.00625FOXO41.14%1.38%
193TGGCCAGCTGGCCA0.00625NEUROD12.75%2.48%
194TGCTTGTACAAGCA0.00648HIFALPHAPAXIP1 TRMT1 RAB18 PRDM10 RBM9 LIN28 CNBP 1.05%0.83%
195GATCTCATGAGATC0.00648HIFALPHAPRDM10 IRF3 CNBP LIN28 1.00%1.21%
196ACCAGCCTGGCCAGGCTGGT0.00648PIR(5.0) SIRT2 ZNF34 RFXANK ZBTB7A SCAND2 TSNAX KHDRBS1 ZNF655 TP73 MAX IRF3 NFATC1 1.62%1.41%
197AGATGCGCATCT0.00649ZNF461 HCFC2 RAN OTEX CBFA2T3 LOC93349 TTRAP CNOT6 ZNF160 ZNF784 TFAM ENO1 ZNF606 ZNF34 MNDA ETV7 IRF8 METTL3 RCOR3 YBX1 ZNF498 RBPJ SMARCAL1 PPIE MAX KHDRBS1 LIN28 ZNF691 IRF3 1.38%1.65%
198CGAGACCATGGTCTCG0.00649SMAD3(5.0) 2.20%1.94%
199GTATACATGTATAC0.00664ARNT1.89%1.65%
200CAACCTCGAGGTTG0.006651.67%1.44%
201TAAAGTACTTTA0.00665KHDRBS1 PRDM10 MEF2B ETV7 IRF3 TTRAP PPIE NFATC1 1.99%1.76%
202TATTTTTAGTACTAAAAATA0.00671MEF2AJARID1D(5.0) SF1(6.4) 1.07%0.91%
203CAAGCAATTGCTTG0.00671SCAND2(6.9) NR1H3 ZNF192 ZNF461 LOC93349 ZNF385 RAN ZNF326 TTRAP NME2 ZBTB4 ZNF606 MAX LIN28 CNBP RCOR3 ZRANB2 PPIE PRDM10 1.09%0.92%
204ATTTTTAGTATACTAAAAAT0.00671JARID1D(5.0) SF1(6.4) 1.10%0.93%
205TCAGGAGATCGATCTCCTGA0.00705RXR/RAR1.05%0.86%
206ATTCTTCGAAGAAT0.00705MEF2A1.23%1.03%
207GATATGCATATC0.007171.26%1.53%
208TGTTGGCGCCAACA0.00752FOXO42.20%1.94%
209ATTTGCATGCAAAT0.00763SPIBJARID1D(7.2) MYEF2(7.1) SNAPC4(7.9) YEATS4(5.3) RBM9(6.7) GPAM LIN28 CNBP 1.07%0.93%
210TGTCAATTGACA0.00763JDP2 ZNF238 IRF3 PRDM10 MAX ZRANB2 PBX2 CNBP LIN28 PKNOX1 MEIS2 2.64%2.36%
211AAATATATATATTT0.00766MEF2A1.01%0.78%
212ATGTTGGCGCCAACAT0.00781.78%1.53%
213CACTCCATGGAGTG0.0078MEF2A2.04%1.80%
214TGAGTGATCACTCA0.00793RORA11.58%1.35%
215AGATCGAGACGTCTCGATCT0.007931.06%0.84%
216AGCACATATGTGCT0.00793SRFHSF1 RAN FOXP4 LIN28 USF2 ZNF345 ZNF124 ZHX3 IKZF1 METTL3 YBX1 ZNF34 ETV7 CREB5 TTRAP ZNF691 ZBTB22 PBX2 SMARCAL1 SOX9 OTEX NME2 RCOR3 IRF8 ZNF498 NFATC1 IRF3 MAX 1.12%0.91%
217CTTGTGATCACAAG0.00793RXR/RARNME1 C13orf15 CBFA2T2 SMARCAL1 ZBTB7A PAXIP1 CNBP DDX20 IRF3 ZNF691 TRMT1 RAB18 CCDC16 PRDM10 1.37%1.15%
218CCTGGCCAATTGGCCAGG0.007931.62%1.41%
219GAAGAAATTTCTTC0.00793STAT1MYEF2 ZNF34 YBX1 ZNF691 LIN28 TTRAP PPIE 2.15%1.92%
220TAGGCTAGCCTA0.007951.15%1.38%
221TGGCCAACATATGTTGGCCA0.007951.42%1.19%
222TTCACCATGCATGGTGAA0.00795CREB3L1(5.5) CCDC16(5.2) 1.56%1.33%
223TCACCATGTACATGGTGA0.00795CREB3L1(5.5) 1.58%1.35%
224ATCCTGGCTAGCCAGGAT0.008151.15%0.97%
225ACTGCACTCGAGTGCAGT0.00815MTF11.24%1.06%
226TCCCACCGGTGGGA0.00815HIFALPHAAFF4(6.2) 1.33%1.15%
227ATCTCCTGATCAGGAGAT0.00815RXR/RAR1.37%1.19%
228TCAATATATTGA0.008152.61%2.35%
229CTCCAGCTGGAG0.00882LIN28 CNBP 3.73%3.41%
230GCTAATTTTAAAATTAGC0.00902PQBP1(6.6) PLAGL1(6.8) 1.28%1.09%
231CAAGTGATCACTTG0.00902HIFALPHA1.42%1.23%
232CGTCTCGAGACG0.009051.90%1.66%
233ACAGAAGCTTCTGT0.00932RORA10.87%1.03%
234TGCTGGATCCAGCA0.00932HIFALPHATGIF1(5.8) 1.05%0.88%
235CTAACATATGTTAG0.009371.44%1.21%
236TGGCCAACATGTTGGCCA0.009371.61%1.38%
237TCTGATGCATCAGA0.00944CREB11.29%1.09%
238TCAAAACGTTTTGA0.00944FOXO4ZBTB22 CBFA2T3 OTEX ZNF34 ZNF461 RCOR3 ING1 YBX1 SMARCAL1 PRDM10 ZNF124 TCF7 KHDRBS1 MAX CREB5 ZNF498 IRF3 ZNF691 1.38%1.18%
239TTTCACCATGGTGAAA0.00944RAB18(6.1) CCDC16(5.2) ZNF193(5.2) 2.08%1.88%
240CCAACATGGTACCATGTTGG0.00952CREB3L1(5.5) 1.25%1.03%
241ATATTTTAAAATAT0.00952ARID3ATP73 NFATC1 IRF3 1.38%1.16%
242GCCAACATGCATGTTGGC0.009521.38%1.16%
243TGGAGTACTCCA0.009653.46%3.18%
244TTGTGATCACAA0.00965LIN28 NPM1 CNBP PPIE PRDM10 4.01%3.73%
245AGTAGATCTACT0.00982GLRX2 ETV7 LIN28 IRF3 MAX 3.45%3.19%